Skip to main content
Premium Trial:

Request an Annual Quote

IP Watch: Recent Patents Related to PCR, Nucleic Acid Amplification, and Sample Prep: Jan 13, 2011

Premium

3M has been awarded US Patent No. 7,867,767, "Valve control system for a rotating multiplex fluorescence detection device."

William Bedingham, Peter Ludowise, and Barry Robole are named as inventors on the patent.

Describes techniques for detecting multiple target species in real-time PCR. The patent specifically describes a system that comprises a data-acquisition device coupled to a detection device that includes a rotating disk having a plurality of process chambers having a plurality of species that emit fluorescent light at different wavelengths. The device further includes a plurality of removable optical modules that are optically configured to excite the species and capture fluorescent light emitted by the species at different wavelengths. A fiber optic bundle coupled to the plurality of removable optical modules conveys the fluorescent light from the optical modules to a single detector. In addition, the device may control the flow of fluid in the disk by locating and selectively opening valves separating chambers by heating the valves with a laser.


Fluidigm has been awarded US Patent No. 7,867,763, "Integrated chip carriers with thermocycler interfaces and methods of using the same."

Geoffrey Facer, Robert Grossman, Marc Unger, Phillip Lam, Hou-Pu Chou, Jake Kimball, Martin Pieprzyk, and Antoine Daridon are named as inventors on the patent.

Provides methods and systems for conducting a reaction at a selected temperature or range of temperatures over time. Provides an array device that contains separate reaction chambers and is formed as an elastomeric block from multiple layers. At least one layer has at least one recess that has at least one deflectable membrane integral to the layer with the recess. The array device has a thermal transfer device proximal to at least one of the reaction chambers. The thermal transfer device is formed to contact a thermal control source. Reagents for carrying out a desired reaction are introduced into the array device. The array device is contacted with a thermal control device in thermal communication with the thermal control source so that a temperature of the reaction in at least one of the reaction chamber is changed as a result of a change in temperature of the thermal control source.


Norchip has been awarded US Patent No. 7,867,757, "Fluid manipulation in a microfabricated reaction chamber system."

Frank Karlsen, Klaus Drese, and Olaf Sorensen are named as inventors on the patent.

Relates to a microfabricated reaction chamber system and a method of fluid transport. The system may be used, for example, in a method of carrying out a nucleic acid sequence amplification and detection process on a nucleic acid sample. The microfabricated chamber system comprises an inlet port and/or an outlet port and a variable volume chamber in fluid communication with said port(s), wherein altering the volume of the variable volume chamber effects and/or restricts flow of a fluid sample to and/or from said port(s).


Lawrence Livermore National Laboratory has been awarded US Patent No. 7,867,713, "Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid."

Shanavaz Nasarabadi is the sole inventor listed on the patent.

Describes a polymerase chain reaction system for analyzing a sample containing nucleic acid. The system includes magnetic beads; a flow channel having a PCR chamber; a pre-PCR magnet position adjacent to the PCR chamber; and a post-pre-polymerase magnet position adjacent to the PCR chamber. The nucleic acid is bound to the magnetic beads, which flow to the pre-PCR magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the PCR chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post-PCR mix containing the nucleic acid. The reaction mix containing the nucleic acid then flows to an analysis unit in the channel for analysis.


Canon has been awarded US Patent No. 7,867,711, "Probe, probe set, probe-immobilized carrier, and genetic testing method."

Hiroto Yoshii, Toshifumi Fukui, and Hideto Kuribayashi are named as inventors on the patent.

Discloses nucleic acid probes capable of collectively detecting bacterial strains of the same species and differentially detecting them from other bacterial species. Any one of the base sequences GGGCTAATACCGGATAGGAGCTCCTG, AAGCGTGAGTGACGGTAATGGGTAAA, or ATCGCGTCGGAAGTGTAATCTTGGG; and complementary or modified sequences thereof or a combination of at least two of them is used for detecting the gene of an infectious disease pathogenic bacterium.


Agilent Technologies has been awarded US Patent No. 7,867,703, "Element defined sequence complexity reduction."

Jeffrey Sampson and Barney Saunders are named as inventors on the patent.

Describes a method for providing defined mixtures of nucleic acids. In certain embodiments, the method uses oligonucleotide probes attached to a solid support as a sequence-specific affinity agent to isolate and facilitate the amplification of defined nucleic acid fragment mixtures.


Epigenomics has been awarded US Patent No. 7,867,701, "Method for the simultaneous amplification of multiple sequences in a PCR reaction and marking thereof."

Jurgen Distler, Kurt Berlin, and Alexander Olek are named as inventors on the patent.

Describes a method for amplifying nucleic acids, in which the segments to be amplified are first hybridized with at least two primer oligonucleotides that have two domains. More specifically, the sequence-specific domain found at the 3-end hybridizes to the segment to be amplified; while the generic domain found at the 5-end does not hybridize. Then an amplification reaction is conducted by means of a polymerase, and a labeled primer oligonucleotide binds to the generic domain of the first primer and is hybridized to the amplificate that is formed. In the last step, the sequence of the amplificate is investigated.

The Scan

J&J Booster Support

A US Food and Drug Administration advisory panel has voted to support a booster dose of Johnson & Johnson's SARS-CoV-2 vaccine, according to the Los Angeles Times.

To Keep the Cases Moving

The president of the UK Royal College of Pathologists tells the Financial Times that more investment is needed to tackle a backlog of cases.

NAS Expels Archaeologist

Science reports Luis Jaime Castillo Butters' expulsion is the first of an international member from the US National Academy of Sciences.

PLOS Papers on Angelman Syndrome-Like Cases, Salmonella Paratyphi A, SARS-CoV-2 in Brazil

In PLOS this week: exome sequencing analysis of Angelman syndrome-like cases, genetic epidemiology of Salmonella Paratyphi A, and more.