Roche Molecular Systems has been awarded US Patent No. 7,844,403, "Temperature step correction with double sigmoid Levenberg-Marquardt and robust linear regression."
Ronald Kurnik is the sole inventor listed on the patent.
Discloses systems and methods for improving Ct determination in PCR amplification curves by correcting PCR data for temperature shifts that may occur during the PCR process. A double sigmoid function with parameters determined by a Levenberg-Marquardt regression process is used to find an approximation to the portion of the curve in the region after the temperature shift, termed "CAC", the cycle where the temperature shift occurred. A robust linear approximation is determined for the portion of the curve in the region before the temperature shift. Values of the fluorescent intensity for the cycle CAC or CAC+1 are determined using both the linear approximation and the LM process, and a difference in these values is subtracted off of the portion of the data set representing the portion of the curve before the temperature shift occurred to produce a shift-corrected data set. The shift-corrected data set may be displayed or otherwise used for further processing.
454 Life Sciences (Roche) has been awarded US Patent No. 7,842,457, "Bead emulsion nucleic acid amplification."
Jan Berka, Yi-Ju Chen, John Leamon, Steve Lefkowitz, Kenton Lohman, Vinod Makhijani, Jonathan Rothberg, Gary Sarkis, Maithreyan Srinivasan, and Michael Weiner are named as inventors on the patent.
Discloses methods for nucleic acid amplification wherein nucleic acid templates, beads, and amplification reaction solution are emulsified and the nucleic acid templates are amplified to provide clonal copies of the nucleic acid templates attached to the beads. The patent also discloses kits and apparatuses for performing the methods.
Canon has been awarded US Patent No. 7,838,656, "Probe, probe set, probe-immobilized carrier, and genetic testing method."
Hiroto Yoshii, Fukui Toshifumi, and Hideto Kuribayashi are named as inventors on the patent.
Describes a nucleic acid probe for classification of pathogenic bacterial species. The probe is capable of collectively detecting bacterial strains of the same species and differentially detecting them from other bacterial species. Any one of the base sequences GGAAGTAACTAGAATATGTAGTGTAGCGGTG, GCCAGTGCAAACTGTGAGGAAGGT, GGGTAGGGGTCCTGAGAGGGAGATC, complementary or modified sequences thereof, or a combination of at least two of them is used for detecting the gene of an infectious disease pathogenic bacterium.
The Japan Science and Technology Agency has been awarded US Patent No. 7,838,269, "Gene detecting method."
Masahiro Goto, Hirofumi Ichinose, Momoko Kitaoka, and Nobuko Okamura are named as inventors on the patent.
Discloses a gene-detecting method for determining mutation of a specific base or presence/absence of a specific base in a target gene. The method involves a target gene sample and a control gene sample having a base sequence which is wild-type or standard-type with respect to the target gene. The method comprises the steps of (1) independently subjecting the target gene sample and the control gene sample to a PCR reaction for amplification, using primers having an RNA polymerase promoter sequence at the 5'-end thereof; (2) independently subjecting the double-stranded DNAs produced by said PCR reaction to an in vitro transcription reaction to form a single-stranded RNA; (3) independently hybridizing the single-stranded RNAs with a fluorescence-labeled probe composed of a single-stranded DNA having a base sequence complementary to at least part of the base sequence of the control gene and being combined with a fluorescent dye, to form an RNA/DNA hybrid; and (5) comparing the fluorescence intensity of the RNA/DNA hybrid derived from the target gene sample with that of the RNA/DNA hybrid derived from the control gene sample.
Enigma Diagnostics has been awarded US Patent No. 7,838,236, "Analytical method and kit."
David Squirrell is the sole inventor listed on the patent.
Describes analytical methods using RNA-containing probes to detect or analyze nucleic acid sequences. The probes are contacted with a sample suspected of containing the nucleic acid sequence and if they form duplexes, they are hydrolyzed. This may be done, for example, during an amplification reaction. AMP generated as a result of the hydrolysis is converted to ATP. The ATP may then be detected using bioluminescent reagents. Inclusion of modified adenosine in at least one probe means that the signal arising from one probe will give rise to a different and distinguishable bioluminescent signal, thus enabling the use of, for example, an internal control in bioluminescently reported nucleic acid tests.
Expression Analytics has been awarded US Patent No. 7,838,228, "Method of quantitative and/or comparative measurement of mRNA expression levels in small biological samples."
Jakob Stenman, Annukka Paju, Oso Rissanen, and Arto Orpana are named as inventors on the patent.
Provides a method for quantitative and/or comparative assessment of the relative amounts of mRNA transcripts present in a cell or tissue sample. In the method, reverse transcription of the mRNA contained in the sample is first carried out using sequence-modifying primers for one or several genes in the same reaction to obtain a pool of sequence-modified cDNA molecules. After completion of the reverse transcription, redundant sequence-modifying primers are removed or inactivated. This step is followed by a step of co-amplifying the sequence-modified cDNA templates with a reference DNA template in individual gene-specific amplification reactions. By quantitatively measuring the amounts and determining the relative levels of the amplification products derived from sequence-modified cDNA and reference DNA templates, a gene-specific cDNA-over-DNA ratio is obtained in each of the individual amplification reactions. Finally, by combining the ratios obtained, a sample-specific profile can be generated, which reflects the relative amounts of mRNA transcripts originally present in the sample.
Hologic has been awarded US Patent No. 7,838,225, "Methods for detection of a target nucleic acid by forming a cleavage structure using a reverse transcriptase."
Joseph Sorge is the sole inventor named on the patent.
Relates to methods for generating a signal indicative of the presence of a target nucleic acid in a sample. The compositions and methods include a reverse transcriptase, a nuclease, an upstream primer, and downstream probe.
Samsung Electronics has been awarded US Patent No. 7,838,036, "Method and apparatus for isolating and purifying nucleic acid using a single surface."
Chang-eun Yoo, Sung-young Jeong, and Young-rok Kim are named as inventors on the patent.
Provides a method of isolating nucleic acid from cells using a single surface, wherein a compound represented by a particular formula is bound to the surface. Also provides an apparatus and beads for isolating nucleic acids.
Fluidigm has been awarded US Patent No. 7,837,946, "Microfluidic device and methods of using same."
Lincoln McBride, Michael Lucero, Marc Unger, Hany Ramez Nassef, and Geoffrey Facer are named as inventors on the patent.
Provides a variety of elastomeric-based microfluidic devices and methods for using and manufacturing such devices. Certain of the devices have arrays of reaction sites to facilitate high-throughput analyses. Some devices also include reaction sites located at the end of blind channels at which reagents have been previously deposited during manufacture. The reagents become suspended once sample is introduced into the reaction site. The devices can be utilized with a variety of heating devices and thus can be used in a variety of analyses requiring temperature control, including thermocycling applications such as nucleic acid amplification reactions, genotyping, and gene expression analyses.